General information

Mutant name 35S:TAS3a
Mutant/Transgenic plant transgenic
Ecotype Col-0
Mutagenesis type
Dominant/Recessive/Semi-dominant
PMID 20363771
CommentNo comment

Mutated genes

Locus name Alias Hormone Mutated site Paper description
AT2G38325 MiR390 auxin Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC

Phenotype information

Organ AttributeNo hormone
Root Lateral rootincreased