You are querying gene by "AT5G53950".

Locus: AT5G53950 Alias: ANAC098

Hormone Evidence Function category Gene Description PMID
CytokininTransgenic Hormone signal transduction Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. 19913077

Basic gene information ( show / hide contents )

Locus AT5G53950 | Chromosome: 5 | Strand: -
Description Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2.
Alias
ANAC098( alias )
CUC2( alias )
Gene model
AT5G53950.1 | From: 21919192 | To: 21921049
Sequence
AT5G53950.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID: 11118137
cellular_component
cellular_component_unknown PMID:
biological_process
regulation of timing of organ formation PMID: 17251269
secondary shoot formation PMID: 18346190
primary shoot apical meristem specification PMID: 10079219
multicellular organismal development PMID:
formation of organ boundary PMID: 9212461
leaf development PMID: 17098808
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   cytokinin   ]

Genotype PMID Type
cuc2-1 AP1::ATIPT4 19913077 transgenic
cuc2-1 cuc3-105 AP1::ATIP4 19913077 transgenic

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT5G53950.1 
length: 1156 
miRNA : ath-miR164a
length: 21 
 
mfe: -44.6 kcal/mol 
p-value: 0.000005 
 
position  801 
target 5' A                    C 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' A                      
 
 
target: AT5G53950.1 
length: 1156 
miRNA : ath-miR164b
length: 21 
 
mfe: -44.6 kcal/mol 
p-value: 0.000022 
 
position  801 
target 5' A                    C 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' A                      
 
 
target: AT5G53950.1 
length: 1156 
miRNA : ath-miR164c
length: 21 
 
mfe: -44.6 kcal/mol 
p-value: 0.000045 
 
position  801 
target 5' A                    C 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' G                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_30394
AccessionTaxon
NP_180019Arabidopsis thaliana
NP_850054Arabidopsis thaliana
NP_001063563Oryza sativa Japonica Group
e_gw1.227.43.1Physcomitrella patens subsp. patens
e_gw1.288.15.1Physcomitrella patens subsp. patens
estExt_gwp_gw1.C_460173Physcomitrella patens subsp. patens
28226.m000851Ricinus communis
NP_200206 ( AT5G53950 )Arabidopsis thaliana
NP_001057578Oryza sativa Japonica Group
27950.m000105Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
SuperFamilySSF1019412.2E-671170IPR003441No apical meristem (NAM) protein
PfamPF023652.9999999999999833E-5017145IPR003441No apical meristem (NAM) protein
PROSITEPS510050.017169IPR003441No apical meristem (NAM) protein