You are querying gene by "AT5G18560".

Locus: AT5G18560 Alias: PUCHI

Hormone Evidence Function category Gene Description PMID
auxinMutant Hormone signal transduction AP2 EREBP transcription factor, induced by auxin 17630277

Basic gene information ( show / hide contents )

Locus AT5G18560 | Chromosome: 5 | Strand: -
Description AP2 EREBP transcription factor, induced by auxin
Alias
PUCHI( alias )
Gene model
AT5G18560.1 | From: 6164589 | To: 6165993
Sequence
AT5G18560.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
DNA binding PMID:
transcription factor activity PMID:
cellular_component
nucleus PMID: 17630277
biological_process
flower development PMID: 17630277
regulation of transcription, DNA-dependent PMID:
lateral root morphogenesis PMID: 17630277
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   auxin   ]

Genotype PMID Type
puchi-1 17630277 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT5G18560.1 
length: 1405 
miRNA : ath-miR829.2
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.000038 
 
position  1284 
target 5' U                    U 
           UACCUUGAAGUUUUGAUUUG  
           AUGGAACUUCGAAAUUAAAC  
miRNA  3' G                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_70518
AccessionTaxon
NP_197357 ( AT5G18560 )Arabidopsis thaliana
NP_001060587Oryza sativa Japonica Group
29726.m004013Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
Gene3DG3DSA:3.30.730.102.1e-2053114IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding
SuperFamilySSF541719.2e-2253114IPR016177DNA-binding, integrase-type
SMARTSM003804.5e-3454117IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding
PROSITEPS5103220.69254111IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding
PRINTSPR003672.4e-075566IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding
PfamPF008471.1e-1455103IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding
PRINTSPR003672.4e-077793IPR001471Pathogenesis-related transcriptional factor/ERF, DNA-binding