You are querying gene by "AT5G13630".

Locus: AT5G13630 Alias: CCH

Hormone Evidence Function category Gene Description PMID
abscisic acidMutant Hormone receptor Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction 17051210

Basic gene information ( show / hide contents )

Locus AT5G13630 | Chromosome: 5 | Strand: -
Description Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction
Alias
CCH( alias )
CCH1( alias )
CHLH( alias )
GUN5( alias )
Gene model
AT5G13630.1 | From: 4387337 | To: 4392230
AT5G13630.2 | From: 4387337 | To: 4392230
Sequence
AT5G13630.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
AT5G13630.2 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
magnesium chelatase activity PMID: 11172074
cellular_component
magnesium chelatase complex PMID: 15815918
mitochondrion PMID: 14671022
chloroplast inner membrane PMID: 11172074
chloroplast PMID: 17135235
biological_process
biosynthetic process PMID:
chlorophyll biosynthetic process PMID:
KEGG pathway This gene participates in 1 pathways:
Pathway Enzyme
Porphyrin and chlorophyll metabolism magnesium chelatase
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   abscisic acid   ]

Genotype PMID Type
cch1-1 17051210 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395a
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.001466 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395b
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.005656 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395c
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.003825 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395d
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.001653 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395e
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.002267 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR395f
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.002814 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.1 
length: 4524 
miRNA : ath-miR773
length: 21 
 
mfe: -28.1 kcal/mol 
p-value: 0.026419 
 
position  3928 
target 5' U       U  G      C     A 
           GAGACAG GA GCUGGA GCAAG  
           CUCUGUU UU CGACCU CGUUU  
miRNA  3'                   U       
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395a
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.001465 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395b
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.005655 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395c
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.003824 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395d
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.001653 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395e
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.002266 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAAGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR395f
length: 21 
 
mfe: -35.2 kcal/mol 
p-value: 0.002813 
 
position  3566 
target 5' A                     G 
           GAGUUUUCUCAAACGCUUCAG  
           CUCAGGGGGGUUUGUGAAGUC  
miRNA  3'                         
 
 
target: AT5G13630.2 
length: 4523 
miRNA : ath-miR773
length: 21 
 
mfe: -28.1 kcal/mol 
p-value: 0.026413 
 
position  3927 
target 5' U       U  G      C     A 
           GAGACAG GA GCUGGA GCAAG  
           CUCUGUU UU CGACCU CGUUU  
miRNA  3'                   U       
 
 
Gene1Gene2Positive/NegativeCategoryEnzyme activityEvidencePMID
AT5G13630AT1G06390PositiveotherN/Amutance17051210
AT5G13630AT1G18890PositiveotherN/Amutance17051210
AT5G13630AT1G25490PositiveotherN/Amolecular17220365
AT5G13630AT1G35670PositiveotherN/Amutance17051210
AT5G13630AT1G72770PositiveotherN/Amutance17051210
AT5G13630AT1G74740PositiveotherN/Amutance17051210
AT5G13630AT2G17290PositiveotherN/Amutance17051210
AT5G13630AT3G11410PositiveotherN/Amutance17051210
AT5G13630AT3G57530PositiveotherN/Amutance17051210
AT5G13630AT4G09570PositiveotherN/Amutance17051210
AT5G13630AT4G16280PositiveotherN/Amutance17051210
AT5G13630AT4G23650PositiveotherN/Amutance17051210
AT5G13630AT4G26080PositiveotherN/Amutance17051210
AT5G13630AT4G33950PositiveotherN/Amutance17051210
AT5G13630AT5G03280negativeotherN/Amutance17051210
AT5G13630AT5G04870PositiveotherN/Amutance17051210
AT5G13630AT5G57050PositiveotherN/Amutance17051210
AT5G13630ATGSK3PositiveotherN/Amutance17051210
AT5G13630[Ca2+]PositiveotherN/Amutance17051210
AT5G13630[NADPHOX]PositiveotherN/Amutance17051210
AT5G13630[S-Anion]negativeotherN/Amutance17051210
AT5G13630cADPR PositiveotherN/Amutance17051210

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_15241
AccessionTaxon
NP_001078578Arabidopsis thaliana
NP_196867 ( AT5G13630 )Arabidopsis thaliana
195524Chlamydomonas reinhardtii
NP_001049972Oryza sativa Japonica Group
NP_001060504Oryza sativa Japonica Group
estExt_gwp_GeneWisePlus.C_Chr_04.00010293Ostreococcus tauri
estExt_Genewise1.C_3480028Physcomitrella patens subsp. patens
fgenesh1_pg.scaffold_348000020Physcomitrella patens subsp. patens
29010.m000224Ricinus communis
105632Chlamydomonas reinhardtii
gw1.05.00.9.1Ostreococcus tauri
DatabaseEntry IDE-valueStartEndInterPro IDDescription
TIGRFAMTIGR020250.0781379IPR011771Magnesium-chelatase, subunit H
TIGRFAMTIGR020250.0781263IPR011771Magnesium-chelatase, subunit H
PfamPF025140.02441363IPR003672CobN/magnesium chelatase
PfamPF025140.02441258IPR003672CobN/magnesium chelatase