You are querying gene by "AT4G26770".

Locus: AT4G26770 Alias: AT4G26770

Expression of this gene is regulated by hormone (see microarray data for this gene), but no genetic evidence or Gene Ontology evidence yet supported that this is a hormone-related gene.

Basic gene information ( show / hide contents )

Locus AT4G26770 | Chromosome: 4 | Strand: +
Description phosphatidate cytidylyltransferase/ transferase, transferring phosphorus-containing groups; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: leaf whorl, petal, flower, pollen tube; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374), Phosphatidate cytidylyltransferase, eukaryota (InterPro:IPR016720); BEST Arabidopsis thaliana protein match is: ATCDS1; phosphatidate cytidylyltransferase (TAIR:AT1G62430.1); Has 4529 Blast hits to 4526 proteins in 1369 species: Archae - 0; Bacteria - 2581; Metazoa - 161; Fungi - 91; Plants - 81; Viruses - 0; Other Eukaryotes - 1615 (source: NCBI BLink).
Alias
AT4G26770( alias )
Gene model
AT4G26770.1 | From: 13482082 | To: 13484846
Sequence
AT4G26770.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
phosphatidate cytidylyltransferase activity PMID:
cellular_component
membrane PMID:
biological_process
phospholipid biosynthetic process PMID:
KEGG pathway This gene participates in 2 pathways:
Pathway Enzyme
Glycerophospholipid metabolism phosphatidate cytidylyltransferase
Phosphatidylinositol signaling system phosphatidate cytidylyltransferase
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT4G26770.1 
length: 1741 
miRNA : ath-miR838
length: 21 
 
mfe: -24.1 kcal/mol 
p-value: 0.023167 
 
position  1716 
target 5' A     C             U 
           GUGUG G AGUAGAAGAGA  
           CACGU C UCAUCUUCUUU  
miRNA  3' A     U U           U 
 
 
target: AT4G26770.1 
length: 1741 
miRNA : ath-miR844
length: 21 
 
mfe: -32.2 kcal/mol 
p-value: 0.000267 
 
position  735 
target 5' A                     A 
           AGCUUGUGAGUGGUCUUAUCA  
           UCGAAUAUUCGUUAGAAUGGU  
miRNA  3'                         
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_10982
AccessionTaxon
NP_001031697Arabidopsis thaliana
NP_176433Arabidopsis thaliana
NP_193965Arabidopsis thaliana
NP_974591Arabidopsis thaliana
128536Chlamydomonas reinhardtii
206150Chlamydomonas reinhardtii
NP_001044302Oryza sativa Japonica Group
NP_001064355Oryza sativa Japonica Group
e_gw1.07.00.213.1Ostreococcus tauri
estExt_Genewise1.C_1060102Physcomitrella patens subsp. patens
29842.m003508Ricinus communis
NP_194407 ( AT4G26770 )Arabidopsis thaliana
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PIRPIRSF0182690.027468IPR016720Phosphatidate cytidylyltransferase, eukaryota
PfamPF011489.699999999999891E-8597428IPR000374Phosphatidate cytidylyltransferase
PROSITEPS013150.0386412IPR000374Phosphatidate cytidylyltransferase