You are querying gene by "AT4G26110".

Locus: AT4G26110 Alias: NAP1;1

Hormone Evidence Function category Gene Description PMID
abscisic acidTransgenic Hormone signal transduction Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. 19825649
Mutant Hormone signal transduction Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. 19825649

Basic gene information ( show / hide contents )

Locus AT4G26110 | Chromosome: 4 | Strand: +
Description Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes.
Alias
NAP1;1( alias )
Gene model
AT4G26110.1 | From: 13232604 | To: 13235888
Sequence
AT4G26110.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
DNA binding PMID:
cellular_component
nucleus PMID:
biological_process
nucleosome assembly PMID:
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   abscisic acid   ]

Genotype PMID Type
m123-2 19825649 mutant
m13-2 19825649 mutant
m23-2 19825649 mutant
m3-2 19825649 mutant
OE1~6 19825649 transgenic

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT4G26110.1 
length: 1613 
miRNA : ath-miR414
length: 21 
 
mfe: -39.4 kcal/mol 
p-value: 0.000009 
 
position  1101 
target 5' G                    A 
           GACGAUGAUGAUGAGGAUGA  
           CUGCUACUACUACUUCUACU  
miRNA  3' A                      
 
 
target: AT4G26110.2 
length: 2016 
miRNA : ath-miR414
length: 21 
 
mfe: -39.4 kcal/mol 
p-value: 0.000013 
 
position  1101 
target 5' G                    A 
           GACGAUGAUGAUGAGGAUGA  
           CUGCUACUACUACUUCUACU  
miRNA  3' A                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_10768
AccessionTaxon
NP_001119060Arabidopsis thaliana
NP_194341 ( AT4G26110 )Arabidopsis thaliana
NP_568844Arabidopsis thaliana
192162Chlamydomonas reinhardtii
NP_001056816Oryza sativa Japonica Group
gw1.13.00.208.1Ostreococcus tauri
e_gw1.1.579.1Physcomitrella patens subsp. patens
estExt_Genewise1.C_3400041Physcomitrella patens subsp. patens
29912.m005339Ricinus communis
NP_001077917Arabidopsis thaliana
NP_179538Arabidopsis thaliana
NP_001056175Oryza sativa Japonica Group
29706.m001351Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PANTHERPTHR118750.039353IPR002164Nucleosome assembly protein (NAP)
PANTHERPTHR118750.039353IPR002164Nucleosome assembly protein (NAP)
PfamPF009567.900000000000156E-8152299IPR002164Nucleosome assembly protein (NAP)
PfamPF009567.099999999999913E-8152299IPR002164Nucleosome assembly protein (NAP)