You are querying gene by "AT3G15170".

Locus: AT3G15170 Alias: anac054

Hormone Evidence Function category Gene Description PMID
ethyleneGeneOntology - response to ethylene stimulus 16359384
auxinGeneOntology - response to auxin stimulus 16359384

Basic gene information ( show / hide contents )

Locus AT3G15170 | Chromosome: 3 | Strand: +
Description response to auxin stimulus
Alias
anac054( alias )
ATNAC1( alias )
CUC1( alias )
Gene model
AT3G15170.1 | From: 5109890 | To: 5111454
Sequence
AT3G15170.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID: 11118137
cellular_component
cellular_component_unknown PMID:
biological_process
negative regulation of cell division PMID: 17287247
secondary shoot formation PMID: 18346190
response to auxin stimulus PMID: 16359384
formation of organ boundary PMID: 9212461
lateral root development PMID: 16359384
response to ethylene stimulus PMID: 16359384
flower development PMID: 9212461
gynoecium development PMID: 10750709
meristem initiation PMID: 9212461
primary shoot apical meristem specification PMID: 16359384
embryonic development PMID: 9212461
response to salt stress PMID: 16359384
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT3G15170.1 
length: 974 
miRNA : ath-miR164a
length: 21 
 
mfe: -44.9 kcal/mol 
p-value: 0.000003 
 
position  664 
target 5' A                    A 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' A                      
 
 
target: AT3G15170.1 
length: 974 
miRNA : ath-miR164b
length: 21 
 
mfe: -44.9 kcal/mol 
p-value: 0.000014 
 
position  664 
target 5' A                    A 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' A                      
 
 
target: AT3G15170.1 
length: 974 
miRNA : ath-miR164c
length: 21 
 
mfe: -44.9 kcal/mol 
p-value: 0.000031 
 
position  664 
target 5' A                    A 
           GCACGUGUCCUGUUUCUCCA  
           CGUGCACGGGACGAAGAGGU  
miRNA  3' G                      
 
 
target: AT3G15170.1 
length: 974 
miRNA : ath-miR171a
length: 21 
 
mfe: -27.0 kcal/mol 
p-value: 0.007231 
 
position  773 
target 5' C    A         G U      G 
           GGUG UGGCGUGGC U UGGUCA  
           CUAU ACCGCGCCG A GUUAGU  
miRNA  3'      A                    
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

No related Ortholog Groups information for this gene.

DatabaseEntry IDE-valueStartEndInterPro IDDescription
SuperFamilySSF1019412.1E-6416173IPR003441No apical meristem (NAM) protein
PfamPF023657.399999999999996E-5020147IPR003441No apical meristem (NAM) protein
PROSITEPS510050.020172IPR003441No apical meristem (NAM) protein