You are querying gene by "AT3G07370".

Locus: AT3G07370 Alias: ATCHIP

Hormone Evidence Function category Gene Description PMID
abscisic acidGeneOntology - response to abscisic acid stimulus 16640601

Basic gene information ( show / hide contents )

Locus AT3G07370 | Chromosome: 3 | Strand: -
Description response to abscisic acid stimulus
Alias
ATCHIP( alias )
CHIP( alias )
Gene model
AT3G07370.1 | From: 2358089 | To: 2360555
Sequence
AT3G07370.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
ubiquitin-protein ligase activity PMID: 16640601
cellular_component
ubiquitin ligase complex PMID:
biological_process
protein ubiquitination PMID: 12805616
response to salt stress PMID: 16640601
response to abscisic acid stimulus PMID: 16640601
response to temperature stimulus PMID: 12805616
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT3G07370.1 
length: 1325 
miRNA : ath-miR837-5p
length: 21 
 
mfe: -30.3 kcal/mol 
p-value: 0.001581 
 
position  1112 
target 5' A                    G 
           UGAAGCGGAUGAGAAAUUGA  
           ACUUUGCUUGUUCUUUGACU  
miRNA  3'                      A 
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_13470
AccessionTaxon
NP_566305 ( AT3G07370 )Arabidopsis thaliana
120414Chlamydomonas reinhardtii
NP_001054406Oryza sativa Japonica Group
0100010270Ostreococcus tauri
e_gw1.338.19.1Physcomitrella patens subsp. patens
estExt_gwp_gw1.C_2450025Physcomitrella patens subsp. patens
29070.m000131Ricinus communis
NP_001060839Oryza sativa Japonica Group
DatabaseEntry IDE-valueStartEndInterPro IDDescription
Gene3DG3DSA:1.25.40.107.400007803983851E-2710163IPR011990Tetratricopeptide-like helical
SMARTSM000280.0589999943046263661043IPR019734Tetratricopeptide repeat
PROSITEPS502930.010111IPR013026Tetratricopeptide repeat-containing
SMARTSM000284.100000492084246E-44477IPR019734Tetratricopeptide repeat
PfamPF005150.0054000000000000014673IPR001440Tetratricopeptide TPR-1
SMARTSM0002827.99999662611634678111IPR019734Tetratricopeptide repeat
PfamPF045643.000000000000004E-25199272IPR003613U box domain
SMARTSM005041.1000015067164208E-27203266IPR003613U box domain