You are querying gene by "AT3G01080".

Locus: AT3G01080 Alias: AtWRKY58

Hormone Evidence Function category Gene Description PMID
salicylic acidMutant Hormone signal transduction transcription factor 17096590

Basic gene information ( show / hide contents )

Locus AT3G01080 | Chromosome: 3 | Strand: +
Description transcription factor
Alias
AtWRKY58( alias )
WRKY58( alias )
Gene model
AT3G01080.1 | From: 25514 | To: 27456
Sequence
AT3G01080.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID:
cellular_component
nucleus PMID:
biological_process
regulation of transcription, DNA-dependent PMID: 10785665
regulation of defense response PMID: 17096590
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   salicylic acid   ]

Genotype PMID Type
wrky58 17096590 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT3G01080.1 
length: 1272 
miRNA : ath-miR399d
length: 21 
 
mfe: -28.3 kcal/mol 
p-value: 0.006117 
 
position  100 
target 5' A   C    U             G 
           CGG GGCG AUUUCU UUGGCG  
           GCC CCGU UAGAGG AACCGU  
miRNA  3'          U      A        
 
 
target: AT3G01080.1 
length: 1272 
miRNA : ath-miR414
length: 21 
 
mfe: -38.4 kcal/mol 
p-value: 0.000009 
 
position  782 
target 5' A                     U 
           UGAUGAUGAUGAUGAAGAUGA  
           ACUGCUACUACUACUUCUACU  
miRNA  3'                         
 
 
Gene1Gene2Positive/NegativeCategoryEnzyme activityEvidencePMID
AT3G01080W-boxnegativetransciptN/Amutance17096590

Ortholog Groups annotation for this gene

No related Ortholog Groups information for this gene.

DatabaseEntry IDE-valueStartEndInterPro IDDescription
SMARTSM007743.4e-35166224IPR003657DNA-binding WRKY
PfamPF031061.6e-29167223IPR003657DNA-binding WRKY
PROSITEPS5081124.030167225IPR003657DNA-binding WRKY
PROSITEPS5081137.539300365IPR003657DNA-binding WRKY
PfamPF031066.2e-31305363IPR003657DNA-binding WRKY
SMARTSM007741.5e-38305364IPR003657DNA-binding WRKY