You are querying gene by "AT2G38325".

Locus: AT2G38325 Alias: MIR390

Hormone Evidence Function category Gene Description PMID
auxinTransgenic Hormone signal transduction Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC 20363771
Mutant Hormone signal transduction Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC 20363771

Basic gene information ( show / hide contents )

Locus AT2G38325 | Chromosome: 2 | Strand: +
Description Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC
Alias
MIR390( alias )
MIR390A( alias )
Gene model
AT2G38325.1 | From: 16069032 | To: 16069138
Sequence
AT2G38325.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene OntologyNo GO annotation data for this gene
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   auxin   ]

Genotype PMID Type
tas3a-1 20363771 mutant
35S:TAS3a 20363771 transgenic

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

No miRNA interaction information for this gene.

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

No related Ortholog Groups information for this gene.

No related Cross Link information for this gene.