You are querying gene by "AT2G22570".

Locus: AT2G22570 Alias: ATNIC1

Hormone Evidence Function category Gene Description PMID
abscisic acidGeneOntology - response to abscisic acid stimulus 17335512

Basic gene information ( show / hide contents )

Locus AT2G22570 | Chromosome: 2 | Strand: -
Description response to abscisic acid stimulus
Alias
ATNIC1( alias )
NIC1( alias )
NIC2( alias )
Gene model
AT2G22570.1 | From: 9596515 | To: 9597959
AT2G22570.2 | From: 9596629 | To: 9597959
Sequence
AT2G22570.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
AT2G22570.2 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
nicotinamidase activity PMID: 17335512
catalytic activity PMID:
cellular_component
cellular_component_unknown PMID:
biological_process
pyridine nucleotide salvage PMID: 17335512
metabolic process PMID:
response to abscisic acid stimulus PMID: 17335512
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT2G22570.1 
length: 937 
miRNA : ath-miR391
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.002792 
 
position  576 
target 5' C      C          A   G 
           GGUGUU UUUCUCCUGU GAA  
           CCGCGA AGAGAGGACG CUU  
miRNA  3' A      U                
 
 
target: AT2G22570.2 
length: 921 
miRNA : ath-miR391
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.002724 
 
position  674 
target 5' C      C          A   G 
           GGUGUU UUUCUCCUGU GAA  
           CCGCGA AGAGAGGACG CUU  
miRNA  3' A      U                
 
 
target: AT2G22570.2 
length: 921 
miRNA : ath-miR417
length: 21 
 
mfe: -30.0 kcal/mol 
p-value: 0.000358 
 
position  538 
target 5' G                     A 
           UUGAACAAGUUUACUGCUUUU  
           AGCUUGUUUAAGUGAUGGAAG  
miRNA  3'                         
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_49829
AccessionTaxon
NP_565539 ( AT2G22570 )Arabidopsis thaliana
NP_001047381Oryza sativa Japonica Group
e_gw1.19.122.1Physcomitrella patens subsp. patens
28535.m000123Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
Gene3DG3DSA:3.40.50.8505.1000100235826005E-2029207IPR000868Isochorismatase-like
SuperFamilySSF524991.4E-2529239IPR000868Isochorismatase-like
Gene3DG3DSA:3.40.50.8504.5000003473935094E-829155IPR000868Isochorismatase-like
SuperFamilySSF524991.7E-1029155IPR000868Isochorismatase-like
PfamPF008576.800000000000057E-3532214IPR000868Isochorismatase-like
PfamPF008571.7999999999999997E-1832157IPR000868Isochorismatase-like