You are querying gene by "AT2G20000".

Locus: AT2G20000 Alias: CDC27b

Hormone Evidence Function category Gene Description PMID
auxinGeneOntology - response to auxin stimulus 12368267

Basic gene information ( show / hide contents )

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT2G20000.1 
length: 2881 
miRNA : ath-miR781
length: 21 
 
mfe: -22.9 kcal/mol 
p-value: 0.133042 
 
position  1396 
target 5' C                    A 
           AAGUAUUUGGGAGGUUCUAA  
           UUCAUAGGUCUUUUGAGAUU  
miRNA  3' A                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_11948
AccessionTaxon
NP_188253Arabidopsis thaliana
NP_849994 ( AT2G20000 )Arabidopsis thaliana
NP_001058099Oryza sativa Japonica Group
e_gw1.06.00.221.1Ostreococcus tauri
e_gw1.31.82.1Physcomitrella patens subsp. patens
fgenesh2_pg.scaffold_136000020Physcomitrella patens subsp. patens
29912.m005456Ricinus communis
178914Chlamydomonas reinhardtii
fgenesh1_pg.C_Chr_06.0001000023Ostreococcus tauri
DatabaseEntry IDE-valueStartEndInterPro IDDescription
SMARTSM000280.30999998844524357101134IPR019734Tetratricopeptide repeat
PROSITEPS500050.0101134IPR019734Tetratricopeptide repeat
PROSITEPS502930.0101134IPR013026Tetratricopeptide repeat-containing
SMARTSM0002861.99999547892939450483IPR019734Tetratricopeptide repeat
PROSITEPS500050.0450483IPR019734Tetratricopeptide repeat
PROSITEPS502930.0450721IPR013026Tetratricopeptide repeat-containing
Gene3DG3DSA:1.25.40.107.900030794430428E-45508719IPR011990Tetratricopeptide-like helical
SMARTSM000283.4999985114892057E-6518551IPR019734Tetratricopeptide repeat
PROSITEPS500050.0518551IPR019734Tetratricopeptide repeat
PfamPF005156.099999999999999E-5519551IPR001440Tetratricopeptide TPR-1
SMARTSM000282.099999940305511552585IPR019734Tetratricopeptide repeat
PROSITEPS500050.0552585IPR019734Tetratricopeptide repeat
SMARTSM000280.014000000733544052586619IPR019734Tetratricopeptide repeat
PROSITEPS500050.0586619IPR019734Tetratricopeptide repeat
PfamPF005150.045000000000000005587618IPR001440Tetratricopeptide TPR-1
SMARTSM0002810.0620653IPR019734Tetratricopeptide repeat
PROSITEPS500050.0620653IPR019734Tetratricopeptide repeat
SMARTSM0002822.99999987979638654687IPR019734Tetratricopeptide repeat
PROSITEPS500050.0654687IPR019734Tetratricopeptide repeat
SMARTSM000287.8000001693841305688721IPR019734Tetratricopeptide repeat
PROSITEPS500050.0688721IPR019734Tetratricopeptide repeat