You are querying gene by "AT2G16940".

Locus: AT2G16940 Alias: AT2G16940

Expression of this gene is regulated by hormone (see microarray data for this gene), but no genetic evidence or Gene Ontology evidence yet supported that this is a hormone-related gene.

Basic gene information ( show / hide contents )

Locus AT2G16940 | Chromosome: 2 | Strand: -
Description RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G09880.1); Has 89001 Blast hits to 40771 proteins in 1338 species: Archae - 64; Bacteria - 6713; Metazoa - 47814; Fungi - 9285; Plants - 6716; Viruses - 445; Other Eukaryotes - 17964 (source: NCBI BLink).
Alias
AT2G16940( alias )
Gene model
AT2G16940.1 | From: 7349689 | To: 7354490
Sequence
AT2G16940.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
nucleic acid binding PMID:
cellular_component
nucleus PMID:
biological_process
mRNA processing PMID:
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT2G16940.1 
length: 2131 
miRNA : ath-miR414
length: 21 
 
mfe: -35.6 kcal/mol 
p-value: 0.000082 
 
position  1317 
target 5' G                    C 
           GAUGAUGAUGAUGGAGGUGG  
           CUGCUACUACUACUUCUACU  
miRNA  3' A                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_12289
AccessionTaxon
NP_565399 ( AT2G16940 )Arabidopsis thaliana
NP_001064686Oryza sativa Japonica Group
fgenesh1_pg.C_Chr_08.0001000205Ostreococcus tauri
estExt_fgenesh1_pg.C_2070055Physcomitrella patens subsp. patens
estExt_gwp_gw1.C_3320014Physcomitrella patens subsp. patens
30183.m001297Ricinus communis
NP_568220Arabidopsis thaliana
DatabaseEntry IDE-valueStartEndInterPro IDDescription
TIGRFAMTIGR016220.071558IPR006509Splicing factor, CC1-like
Gene3DG3DSA:3.30.70.3303.399999724376874E-22110257IPR012677Nucleotide-binding, alpha-beta plait
PANTHERPTHR10432:SF600.0177558IPR006509Splicing factor, CC1-like
PROSITEPS501020.0182259IPR000504RNA recognition motif, RNP-1
SMARTSM003603.599996434359868E-16183255IPR000504RNA recognition motif, RNP-1
PfamPF000765.000000000000002E-7192252IPR000504RNA recognition motif, RNP-1
Gene3DG3DSA:3.30.70.3306.39998633403594E-23285400IPR012677Nucleotide-binding, alpha-beta plait
PROSITEPS501020.0285362IPR000504RNA recognition motif, RNP-1
SMARTSM003603.399999724377172E-24286358IPR000504RNA recognition motif, RNP-1
PfamPF000766.79999999999998E-17287356IPR000504RNA recognition motif, RNP-1
Gene3DG3DSA:3.30.70.3309.199984144203112E-24461557IPR012677Nucleotide-binding, alpha-beta plait
PROSITEPS501020.0465548IPR000504RNA recognition motif, RNP-1
SMARTSM003601.6999992228404958E-7466544IPR000504RNA recognition motif, RNP-1
PfamPF000760.14488541IPR000504RNA recognition motif, RNP-1