You are querying gene by "AT1G77850".

Locus: AT1G77850 Alias: ARF17

Hormone Evidence Function category Gene Description PMID
auxinMutant Hormone signal transduction transcription factor 16006581
GeneOntology - auxin mediated signaling pathway 15829600

Basic gene information ( show / hide contents )

Locus AT1G77850 | Chromosome: 1 | Strand: +
Description transcription factor
Alias
ARF17( alias )
Gene model
AT1G77850.1 | From: 29277207 | To: 29280313
Sequence
AT1G77850.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID: 11118137
cellular_component
nucleus PMID:
biological_process
anatomical structure morphogenesis PMID: 15829600
adventitious root development PMID: 15829601
auxin mediated signaling pathway PMID: 15829600
regulation of transcription PMID: 11118137
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   auxin   ]

Genotype PMID Type
mARF17-D 16006581 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT1G77850.1 
length: 2076 
miRNA : ath-miR160a
length: 21 
 
mfe: -51.4 kcal/mol 
p-value: 0.000003 
 
position  1408 
target 5' C                     A 
           UGGCAUGCAGGGAGCCAGGCA  
           ACCGUAUGUCCCUCGGUCCGU  
miRNA  3'                         
 
 
target: AT1G77850.1 
length: 2076 
miRNA : ath-miR160b
length: 21 
 
mfe: -51.4 kcal/mol 
p-value: 0.000004 
 
position  1408 
target 5' C                     A 
           UGGCAUGCAGGGAGCCAGGCA  
           ACCGUAUGUCCCUCGGUCCGU  
miRNA  3'                         
 
 
target: AT1G77850.1 
length: 2076 
miRNA : ath-miR160c
length: 21 
 
mfe: -51.4 kcal/mol 
p-value: 0.000017 
 
position  1408 
target 5' C                     A 
           UGGCAUGCAGGGAGCCAGGCA  
           ACCGUAUGUCCCUCGGUCCGU  
miRNA  3'                         
 
 
Gene1Gene2Positive/NegativeCategoryEnzyme activityEvidencePMID
AT1G77850AT1G74740PositivetransciptN/Amolecular18599455
AT1G77850AT2G14610negativetransciptN/Abiochem17276977
AT1G77850AT4G30610PositivetransciptN/AGO/othersN/A
AT1G77850AT5G18560PositivetransciptN/Amutance17630277
AT1G77850CBF/DREBnegativetransciptN/Abiochem17276977

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_91797
AccessionTaxon
NP_565161 ( AT1G77850 )Arabidopsis thaliana
29908.m005953Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PfamPF023628.000000000000008E-20119220IPR003340Transcriptional factor B3
PROSITEPS508630.0119221IPR003340Transcriptional factor B3
PfamPF065078.800000000000028E-22274356IPR010525Auxin response factor