You are querying gene by "AT1G76090".

Locus: AT1G76090 Alias: SMT3

Expression of this gene is regulated by hormone (see microarray data for this gene), but no genetic evidence or Gene Ontology evidence yet supported that this is a hormone-related gene.

Basic gene information ( show / hide contents )

Locus AT1G76090 | Chromosome: 1 | Strand: -
Description sterol-C24-methyltransferases
Alias
SMT3( alias )
Gene model
AT1G76090.1 | From: 28555303 | To: 28556675
Sequence
AT1G76090.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
sterol 24-C-methyltransferase activity PMID: 9208946
S-adenosylmethionine-dependent methyltransferase activity PMID:
cellular_component
endoplasmic reticulum PMID: 12215504
biological_process
sterol biosynthetic process PMID: 12215504
KEGG pathway This gene participates in 1 pathways:
Pathway Enzyme
Other enzymes 24-methylenesterol C-methyltransferase
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

No genetic evidence yet supported that this is a hormone-related gene.

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR833-5p
length: 22 
 
mfe: -26.1 kcal/mol 
p-value: 0.009079 
 
position  573 
target 5' A  G  U   A            C 
           AC AG ACC AGUGCAACGAGC  
           UG UC UGG UCAUGUUGUUUG  
miRNA  3'    A      C            U 
 
 
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR854a
length: 21 
 
mfe: -33.6 kcal/mol 
p-value: 0.002147 
 
position  1201 
target 5' A                    U 
           UCUUCUUCCUUGUUCUCGUU  
           AGGAGGAGGGAUAGGAGUAG  
miRNA  3' G                      
 
 
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR854b
length: 21 
 
mfe: -33.6 kcal/mol 
p-value: 0.001302 
 
position  1201 
target 5' A                    U 
           UCUUCUUCCUUGUUCUCGUU  
           AGGAGGAGGGAUAGGAGUAG  
miRNA  3' G                      
 
 
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR854c
length: 21 
 
mfe: -33.6 kcal/mol 
p-value: 0.001788 
 
position  1201 
target 5' A                    U 
           UCUUCUUCCUUGUUCUCGUU  
           AGGAGGAGGGAUAGGAGUAG  
miRNA  3' G                      
 
 
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR854d
length: 21 
 
mfe: -33.6 kcal/mol 
p-value: 0.001380 
 
position  1201 
target 5' A                    U 
           UCUUCUUCCUUGUUCUCGUU  
           AGGAGGAGGGAUAGGAGUAG  
miRNA  3' G                      
 
 
target: AT1G76090.1 
length: 1373 
miRNA : ath-miR854e
length: 21 
 
mfe: -33.6 kcal/mol 
p-value: 0.001897 
 
position  1201 
target 5' A                    U 
           UCUUCUUCCUUGUUCUCGUU  
           AGGAGGAGGGAUAGGAGUAG  
miRNA  3' G                      
 
 

No related Gene interaction information for this gene.

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_33377
AccessionTaxon
NP_173458Arabidopsis thaliana
NP_177736 ( AT1G76090 )Arabidopsis thaliana
NP_001048891Oryza sativa Japonica Group
e_gw1.08.00.232.1Ostreococcus tauri
e_gw1.205.27.1Physcomitrella patens subsp. patens
fgenesh1_pg.scaffold_148000025Physcomitrella patens subsp. patens
fgenesh2_pg.scaffold_148000001Physcomitrella patens subsp. patens
30170.m014288Ricinus communis
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PfamPF082412.200000000000004E-17128225IPR013216Methyltransferase type 11
PfamPF084983.500000000000003E-12293355IPR013705Sterol methyltransferase C-terminal