You are querying gene by "AT1G30330".

Locus: AT1G30330 Alias: ARF6

Hormone Evidence Function category Gene Description PMID
auxinMutant Hormone signal transduction transcription factor 17021043
GeneOntology - response to auxin stimulus 16107481

Basic gene information ( show / hide contents )

Locus AT1G30330 | Chromosome: 1 | Strand: -
Description transcription factor
Alias
ARF6( alias )
Gene model
AT1G30330.1 | From: 10685804 | To: 10690781
AT1G30330.2 | From: 10685804 | To: 10690018
Sequence
AT1G30330.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
AT1G30330.2 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID: 11118137
cellular_component
nucleus PMID:
biological_process
flower development PMID: 16107481
response to auxin stimulus PMID: 16107481
regulation of transcription, DNA-dependent PMID:
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   auxin   ]

Genotype PMID Type
arf6arf8 16107481 17021043 mutant
mARF6 (ARF6-D) 17021043 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR167c
length: 21 
 
mfe: -37.7 kcal/mol 
p-value: 0.000542 
 
position  3276 
target 5' U       G            U 
           GAGAUCA GCUGGCAGCUUG  
           UUCUAGU CGACCGUCGAAU  
miRNA  3' G       A              
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR838
length: 21 
 
mfe: -27.4 kcal/mol 
p-value: 0.012381 
 
position  604 
target 5' A  G                  C 
           UG GUGGGAGGUGGAGGGAAA  
           AC CGUUCUUCAUCUUCUUUU  
miRNA  3'    A                    
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR854a
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.017655 
 
position  124 
target 5' U                     U 
           CUCUUUCUUUCUAUCUUUGUC  
           GAGGAGGAGGGAUAGGAGUAG  
miRNA  3'                         
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR854b
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.015895 
 
position  124 
target 5' U                     U 
           CUCUUUCUUUCUAUCUUUGUC  
           GAGGAGGAGGGAUAGGAGUAG  
miRNA  3'                         
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR854c
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.017428 
 
position  124 
target 5' U                     U 
           CUCUUUCUUUCUAUCUUUGUC  
           GAGGAGGAGGGAUAGGAGUAG  
miRNA  3'                         
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR854d
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.016191 
 
position  124 
target 5' U                     U 
           CUCUUUCUUUCUAUCUUUGUC  
           GAGGAGGAGGGAUAGGAGUAG  
miRNA  3'                         
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR854e
length: 21 
 
mfe: -31.1 kcal/mol 
p-value: 0.018072 
 
position  124 
target 5' U                     U 
           CUCUUUCUUUCUAUCUUUGUC  
           GAGGAGGAGGGAUAGGAGUAG  
miRNA  3'                         
 
 
target: AT1G30330.1 
length: 3868 
miRNA : ath-miR869.2
length: 21 
 
mfe: -24.4 kcal/mol 
p-value: 0.123764 
 
position  2427 
target 5' A   U  U        G   C 
           UCA CU UCUCAGCA CAG  
           AGU GA AGAGUUGU GUC  
miRNA  3' C   U  U        G   U 
 
 
target: AT1G30330.2 
length: 3111 
miRNA : ath-miR167c
length: 21 
 
mfe: -37.7 kcal/mol 
p-value: 0.000403 
 
position  2519 
target 5' U       G            U 
           GAGAUCA GCUGGCAGCUUG  
           UUCUAGU CGACCGUCGAAU  
miRNA  3' G       A              
 
 
target: AT1G30330.2 
length: 3111 
miRNA : ath-miR869.2
length: 21 
 
mfe: -24.4 kcal/mol 
p-value: 0.098356 
 
position  1670 
target 5' A   U  U        G   C 
           UCA CU UCUCAGCA CAG  
           AGU GA AGAGUUGU GUC  
miRNA  3' C   U  U        G   U 
 
 
Gene1Gene2Positive/NegativeCategoryEnzyme activityEvidencePMID
AT1G30330AT1G74740PositivetransciptN/Amolecular18599455
AT1G30330AT2G14610negativetransciptN/Abiochem17276977
AT1G30330AT4G30610PositivetransciptN/AGO/othersN/A
AT1G30330AT5G18560PositivetransciptN/Amutance17630277
AT1G30330CBF/DREBnegativetransciptN/Abiochem17276977

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_19971
AccessionTaxon
NP_001031115Arabidopsis thaliana
NP_001078672Arabidopsis thaliana
NP_174323 ( AT1G30330 )Arabidopsis thaliana
NP_198518Arabidopsis thaliana
NP_001045993Oryza sativa Japonica Group
NP_001054222Oryza sativa Japonica Group
NP_001058360Oryza sativa Japonica Group
NP_001067266Oryza sativa Japonica Group
e_gw1.119.103.1Physcomitrella patens subsp. patens
e_gw1.133.91.1Physcomitrella patens subsp. patens
e_gw1.65.212.1Physcomitrella patens subsp. patens
e_gw1.86.122.1Physcomitrella patens subsp. patens
estExt_fgenesh1_pg.C_1630077Physcomitrella patens subsp. patens
gw1.6.284.1Physcomitrella patens subsp. patens
29599.m000177Ricinus communis
29769.m000463Ricinus communis
30170.m014161Ricinus communis
NP_173414Arabidopsis thaliana
NP_001054169Oryza sativa Japonica Group
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PfamPF023623.799999999999998E-18127228IPR003340Transcriptional factor B3
PROSITEPS508630.0127229IPR003340Transcriptional factor B3
PfamPF023624.8e-21129230IPR003340Transcriptional factor B3
PROSITEPS5086312.464129231IPR003340Transcriptional factor B3
PfamPF065075.4999999999999514E-33253336IPR010525Auxin response factor
PfamPF065077e-36255338IPR010525Auxin response factor
PfamPF023094.5000000000000035E-17789885IPR003311AUX/IAA protein
PfamPF023095.7e-20791887IPR003311AUX/IAA protein
PROSITEPS509620.0795877IPR011525Aux/IAA-ARF-dimerisation
PROSITEPS5096224.777797879IPR011525Aux/IAA-ARF-dimerisation