You are querying gene by "AT1G04240".

Locus: AT1G04240 Alias: IAA3

Hormone Evidence Function category Gene Description PMID
auxinMutant Hormone signal transduction 9895319
GeneOntology - response to auxin stimulus 11884676

Basic gene information ( show / hide contents )

Locus AT1G04240 | Chromosome: 1 | Strand: -
Description
Alias
IAA3( alias )
SHY2( alias )
Gene model
AT1G04240.1 | From: 1128187 | To: 1129550
Sequence
AT1G04240.1 | Genomic | cDNA | CDS | Protein | Upstream 1K | Downstream 1K
Gene Ontology
molecular_function
transcription factor activity PMID: 11118137
cellular_component
nucleus PMID:
biological_process
response to auxin stimulus PMID: 11884676
KEGG pathway No data
PPI Get protein-protein interactions by Arabidopsis Interactions Viewer

Hormone-related mutants or transgenic plants associated with this gene

[   auxin   ]

Genotype PMID Type
shy2-2 9895319 mutant
shy2-22 9895319 mutant

Microarray data for this gene

  1  
Hormone treatment related datasets  
  2  
Abiotic stress treatment related datasets (in root)  
  3  
Abiotic stress treatment related datasets (in shoot)  
  4  
Development related datasets  

miRNA interaction information for this gene

Detail
(Note:target use cDNA sequence)
target: AT1G04240.1 
length: 1178 
miRNA : ath-miR159a
length: 21 
 
mfe: -28.2 kcal/mol 
p-value: 0.008603 
 
position  852 
target 5' A                     G 
           UAGAGUUUCUUUUGGUUCAGA  
           AUCUCGAGGGAAGUUAGGUUU  
miRNA  3'                         
 
 
target: AT1G04240.1 
length: 1178 
miRNA : ath-miR159b
length: 21 
 
mfe: -26.9 kcal/mol 
p-value: 0.014965 
 
position  853 
target 5' U                    G 
           AGAGUUUCUUUUGGUUCAGA  
           UCUCGAGGGAAGUUAGGUUU  
miRNA  3' U                      
 
 
Gene1Gene2Positive/NegativeCategoryEnzyme activityEvidencePMID
AT1G04240AT1G19220negativeotherN/Amutance17900969
AT1G04240AT1G19850negativeotherN/Amutance17900969
AT1G04240AT1G23080negativeotherN/Amolecular19039136
AT1G04240AT1G30330negativeotherN/Amutance17900969
AT1G04240AT1G51190negativeotherN/Amolecular19039136
AT1G04240AT1G59750negativeotherN/Amutance17900969
AT1G04240AT1G70940negativeotherN/Amolecular19039136
AT1G04240AT1G73590negativeotherN/Amolecular19039136
AT1G04240AT1G77110negativeotherN/Amolecular19039136
AT1G04240AT1G77850negativeotherN/Amutance17900969
AT1G04240AT2G01420negativeotherN/Amolecular19039136
AT1G04240AT2G24765negativeotherN/Amutance17900969
AT1G04240AT2G28350negativeotherN/Amutance17900969
AT1G04240AT2G34650negativeotherN/Amolecular19039136
AT1G04240AT2G47000negativeotherN/Amolecular19039136
AT1G04240AT3G20840negativeotherN/Amolecular19039136
AT1G04240AT3G28860negativeotherN/Amolecular19039136
AT1G04240AT4G30080negativeotherN/Amutance17900969
AT1G04240AT5G13930negativeotherN/Amolecular19039136
AT1G04240AT5G15100negativeotherN/Amolecular19039136
AT1G04240AT5G16530negativeotherN/Amolecular19039136
AT1G04240AT5G20730negativeotherN/Amutance17900969
AT1G04240AT5G37020negativeotherN/Amutance17900969
AT1G04240AT5G57090negativeotherN/Amolecular19039136
AT1G04240AT5G60450negativeotherN/Amutance17900969
AT1G04240AT5G62000negativeotherN/Amutance17900969

Ortholog Groups annotation for this gene

Ortholog Groups : OG4_40735
AccessionTaxon
NP_171920 ( AT1G04240 )Arabidopsis thaliana
NP_199183Arabidopsis thaliana
NP_001050714Oryza sativa Japonica Group
NP_001067210Oryza sativa Japonica Group
29844.m003175Ricinus communis
NP_001051565Oryza sativa Japonica Group
NP_001059051Oryza sativa Japonica Group
DatabaseEntry IDE-valueStartEndInterPro IDDescription
PfamPF023097.4e-705187IPR003311AUX/IAA protein
PROSITEPS5096229.11993180IPR011525Aux/IAA-ARF-dimerisation